Skip to content
Merged
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
58 changes: 55 additions & 3 deletions doc/specs/stdlib_strings.md
Original file line number Diff line number Diff line change
Expand Up @@ -280,7 +280,7 @@ end program demo_slice
Returns the starting index of the `occurrence`th occurrence of the substring `pattern`
in the input string `string`.
Default value of `occurrence` is set to `1`.
If `consider_overlapping` is not provided or is set to `.true.` the function counts two overlapping occurrences of substring as two different occurrences.
If `consider_overlapping` is not provided or is set to `.true.` the function counts two overlapping occurrences of substring `pattern` as two different occurrences.
If `occurrence`th occurrence is not found, function returns `0`.

#### Syntax
Expand Down Expand Up @@ -308,7 +308,7 @@ Elemental function

#### Result value

The result is a scalar of integer type or integer array of rank equal to the highest rank among all dummy arguments.
The result is a scalar of integer type or an integer array of rank equal to the highest rank among all dummy arguments.

#### Example

Expand Down Expand Up @@ -381,4 +381,56 @@ program demo_replace_all
! string <-- "technology here, technology there, technology everywhere"

end program demo_replace_all
```
```


<!-- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -->
### `count`

#### Description

Returns the number of times the substring `pattern` has occurred in the input string `string`.
If `consider_overlapping` is not provided or is set to `.true.` the function counts two overlapping occurrences of substring `pattern` as two different occurrences.

#### Syntax

`string = [[stdlib_strings(module):count(interface)]] (string, pattern [, consider_overlapping])`

#### Status

Experimental

#### Class

Elemental function

#### Argument

- `string`: Character scalar or [[stdlib_string_type(module):string_type(type)]].
This argument is intent(in).
- `pattern`: Character scalar or [[stdlib_string_type(module):string_type(type)]].
This argument is intent(in).
- `consider_overlapping`: logical.
This argument is intent(in) and optional.

#### Result value

The result is a scalar of integer type or an integer array of rank equal to the highest rank among all dummy arguments.

#### Example

```fortran
program demo_count
use stdlib_string_type, only: string_type, assignment(=)
use stdlib_strings, only : count
implicit none
type(string_type) :: string

string = "How much wood would a woodchuck chuck if a woodchuck could chuck wood?"

print *, count(string, "wood") ! 4
print *, count(string, ["would", "chuck", "could"]) ! [1, 4, 1]
print *, count("a long queueueueue", "ueu", [.false., .true.]) ! [2, 4]

end program demo_count
```
99 changes: 95 additions & 4 deletions src/stdlib_strings.f90
Original file line number Diff line number Diff line change
Expand Up @@ -12,7 +12,7 @@ module stdlib_strings

public :: strip, chomp
public :: starts_with, ends_with
public :: slice, find, replace_all
public :: slice, find, replace_all, count


!> Remove leading and trailing whitespace characters.
Expand Down Expand Up @@ -93,6 +93,18 @@ module stdlib_strings
module procedure :: replace_all_char_char_char
end interface replace_all

!> Version: experimental
!>
!> Returns the number of times substring 'pattern' has appeared in the
!> input string 'string'
!> [Specifications](../page/specs/stdlib_strings.html#count)
interface count
module procedure :: count_string_string
module procedure :: count_string_char
module procedure :: count_char_string
module procedure :: count_char_char
end interface count

contains


Expand Down Expand Up @@ -443,9 +455,7 @@ elemental function find_char_char(string, pattern, occurrence, consider_overlapp
logical, intent(in), optional :: consider_overlapping
integer :: lps_array(len(pattern))
integer :: res, s_i, p_i, length_string, length_pattern, occurrence_
logical :: consider_overlapping_

consider_overlapping_ = optval(consider_overlapping, .true.)
occurrence_ = optval(occurrence, 1)
res = 0
length_string = len(string)
Expand All @@ -464,7 +474,7 @@ elemental function find_char_char(string, pattern, occurrence, consider_overlapp
if (occurrence_ == 0) then
res = s_i - length_pattern + 1
exit
else if (consider_overlapping_) then
else if (optval(consider_overlapping, .true.)) then
p_i = lps_array(p_i)
else
p_i = 0
Expand Down Expand Up @@ -649,4 +659,85 @@ pure function replace_all_char_char_char(string, pattern, replacement) result(re

end function replace_all_char_char_char

!> Returns the number of times substring 'pattern' has appeared in the
!> input string 'string'
!> Returns an integer
elemental function count_string_string(string, pattern, consider_overlapping) result(res)
type(string_type), intent(in) :: string
type(string_type), intent(in) :: pattern
logical, intent(in), optional :: consider_overlapping
integer :: res

res = count(char(string), char(pattern), consider_overlapping)

end function count_string_string

!> Returns the number of times substring 'pattern' has appeared in the
!> input string 'string'
!> Returns an integer
elemental function count_string_char(string, pattern, consider_overlapping) result(res)
type(string_type), intent(in) :: string
character(len=*), intent(in) :: pattern
logical, intent(in), optional :: consider_overlapping
integer :: res

res = count(char(string), pattern, consider_overlapping)

end function count_string_char

!> Returns the number of times substring 'pattern' has appeared in the
!> input string 'string'
!> Returns an integer
elemental function count_char_string(string, pattern, consider_overlapping) result(res)
character(len=*), intent(in) :: string
type(string_type), intent(in) :: pattern
logical, intent(in), optional :: consider_overlapping
integer :: res

res = count(string, char(pattern), consider_overlapping)

end function count_char_string

!> Returns the number of times substring 'pattern' has appeared in the
!> input string 'string'
!> Returns an integer
elemental function count_char_char(string, pattern, consider_overlapping) result(res)
character(len=*), intent(in) :: string
character(len=*), intent(in) :: pattern
logical, intent(in), optional :: consider_overlapping
integer :: lps_array(len(pattern))
integer :: res, s_i, p_i, length_string, length_pattern

res = 0
length_string = len(string)
length_pattern = len(pattern)

if (length_pattern > 0 .and. length_pattern <= length_string) then
lps_array = compute_lps(pattern)

s_i = 1
p_i = 1
do while (s_i <= length_string)
if (string(s_i:s_i) == pattern(p_i:p_i)) then
if (p_i == length_pattern) then
res = res + 1
if (optval(consider_overlapping, .true.)) then
p_i = lps_array(p_i)
else
p_i = 0
end if
end if
s_i = s_i + 1
p_i = p_i + 1
else if (p_i > 1) then
p_i = lps_array(p_i - 1) + 1
else
s_i = s_i + 1
end if
end do
end if

end function count_char_char


end module stdlib_strings
50 changes: 47 additions & 3 deletions src/tests/string/test_string_functions.f90
Original file line number Diff line number Diff line change
Expand Up @@ -4,7 +4,7 @@ module test_string_functions
use stdlib_error, only : check
use stdlib_string_type, only : string_type, assignment(=), operator(==), &
to_lower, to_upper, to_title, to_sentence, reverse
use stdlib_strings, only: slice, find, replace_all
use stdlib_strings, only: slice, find, replace_all, count
use stdlib_optval, only: optval
use stdlib_ascii, only : to_string
implicit none
Expand Down Expand Up @@ -355,8 +355,8 @@ subroutine test_replace_all
call check(replace_all(test_string_1, "TAT", "ATA") == &
& "mutate DNA sequence: GTATACGATAGCCGTAATATA", &
& "replace_all: 1 string_type & 2 character scalar, test case 1")
call check(replace_all("mutate DNA sequence: AGAGAGCCTAGAGAGAG", test_pattern_2, &
& "GC") == "mutate DNA sequence: GCGAGCCTGCGGCG", &
call check(replace_all("mutate DNA sequence: AGAGAGCCTAGAGAGAG", test_pattern_2, "GC") == &
& "mutate DNA sequence: GCGAGCCTGCGGCG", &
& "replace_all: 1 string_type & 2 character scalar, test case 2")
call check(replace_all("mutate DNA sequence: GTTATCGTATGCCGTAATTAT", "TA", &
& test_replacement_2) == "mutate DNA sequence: GTagaTCGagaTGCCGagaATagaT", &
Expand All @@ -378,6 +378,49 @@ subroutine test_replace_all

end subroutine test_replace_all

subroutine test_count
type(string_type) :: test_string_1, test_string_2, test_pattern_1, test_pattern_2
test_string_1 = "DNA sequence: AGAGAGAGTCCTGTCGAGA"
test_string_2 = "DNA sequence: GTCCTGTCCTGTCAGA"
test_pattern_1 = "AGA"
test_pattern_2 = "GTCCTGTC"

! all 2 as string_type
call check(all(count([test_string_1, test_string_2], test_pattern_1) == [4, 1]), &
& 'count: all 2 as string_type, test case 1')
call check(all(count(test_string_1, [test_pattern_1, test_pattern_2], .false.) == [3, 1]), &
& 'count: all 2 as string_type, test case 2')
call check(count(test_string_2, test_pattern_1, .false.) == 1, &
& 'count: all 2 as string_type, test case 3')
call check(all(count([test_string_2, test_string_2, test_string_1], &
& [test_pattern_2, test_pattern_2, test_pattern_1], [.true., .false., .false.]) == &
& [2, 1, 3]), 'count: all 2 as string_type, test case 4')
call check(all(count([[test_string_1, test_string_2], [test_string_1, test_string_2]], &
& [[test_pattern_1, test_pattern_2], [test_pattern_2, test_pattern_1]], .true.) == &
& [[4, 2], [1, 1]]), 'count: all 2 as string_type, test case 5')

! 1 string_type and 1 character scalar
call check(all(count(test_string_1, ["AGA", "GTC"], [.true., .false.]) == [4, 2]), &
& 'count: 1 string_type and 1 character scalar, test case 1')
call check(all(count([test_string_1, test_string_2], ["CTC", "GTC"], [.true., .false.]) == &
& [0, 3]), 'count: 1 string_type and 1 character scalar, test case 2')
call check(all(count(["AGAGAGAGTCCTGTCGAGA", "AGAGAGAGTCCTGTCGAGA"], &
& test_pattern_1, [.false., .true.]) == [3, 4]), &
& 'count: 1 string_type and 1 character scalar, test case 3')
call check(count(test_string_1, "GAG") == 4, &
& 'count: 1 string_type and 1 character scalar, test case 4')
call check(count("DNA sequence: GTCCTGTCCTGTCAGA", test_pattern_2, .false.) == 1, &
& 'count: 1 string_type and 1 character scalar, test case 5')

! all 2 character scalar
call check(all(count("", ["mango", "trees"], .true.) == [0, 0]), &
& 'count: all 2 character scalar, test case 1')
call check(count("", "", .true.) == 0, 'count: all 2 character scalar, test case 2')
call check(all(count(["mango", "trees"], "", .true.) == [0, 0]), &
& 'count: all 2 character scalar, test case 3')

end subroutine test_count

end module test_string_functions


Expand All @@ -394,5 +437,6 @@ program tester
call test_slice_gen
call test_find
call test_replace_all
call test_count

end program tester